                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.22 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agtgaggaaaagggtaaattttgttcctctagttgttaatcctcctttatccgggaaggctcttgtttgcaattctgtgtatggagcgtgggctagtgcc
ttaggaatgcgtagagagcagagatcactgtaagaaaacttttatggtttttagttgtgctgcggattttatagcaaaagggtacttcttgtccggtagg
aggaggctgttttgctaggggctctcatttctaagtattttatgtggtgagggtgtagtaagaatcagtctcttttttaagagcccaagtaaggcatatt
ATG

    rl36 --- rs14 Gene: rl36     GI: 15605519     BI number: CT786     GOG: COG0257     Description: L36 Ribosomal Protein Gene: rs14     GI: 15605520     BI number: CT787     GOG: COG0199     Description: S14 Ribosomal Protei   t t  a t  t tg cg at at        aa at       a  g at       a  g gt        cg |  a       gt |  g      |  a |  t      a  c |  t      t  t a  g      a  t at       t  c tg       t  t gc       t  t |  t       tg        gt t  g       at       g  a c  c       gc        cg a  g       gc        cg cg        cg        ta ta       g  |      g  g at       t  |       tg gt        cg        ta at        gt        cg gt        ta        tg                         ctgttttgctaggggctctcatttctaagtattttatgtggtgagggtgtagtaagaatcagtctcttttttaagagcccaagtaaggcatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0257 Ribosomal protein L36 ... can be seen here [J] COG0199 Ribosomal protein S14 ... can be seen here     ..................................................................................................................