Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:177 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATATTCTATATTTGAATTCATtaaaaaataatgggttcgctttcgtttttgaaaaaacaatattaacgagtagatgatttctt
ttctaaaaaagctcctgtctacaagttagggagcgtttttagaaagagagcagctttgatcttgttattgacttagattgcagtaacttttaccctcgtc
tccagtaactttcttggtaaaaaaagcttttgaaagtgttgctgttaaaaattttttggcatagaaatagagctgaatagaagagacaagatcacgagaa
tgaggcagccgagagtATG

    CT790


Gene: CT790     GI: 15605523     BI number: CT790     GOG: COG1302     Description: hypothetical protei


 aa
a  a
a  a
 gc
 ta
 ta
|  t
|  a
|  t
t  t
 ta        ta
 ta       c  a
 gc        ta
 cg        ta
 ta        ta
 tg        ta         c
|  t       cg       a  a
 ta       t  c       ta
 cg       t  t       cg
|  a      t  c      |  t
 gt       a  c      t  t
 cg       g  t      g  a
 ta        tg        tg
|  t       at        cg
t  t       gc        cg
 gt        at        ta
 gc        ta        cg
 gt        gc        gc
                        gtttttagaaagagagcagctttgatcttgttattgacttagattgcagtaacttttaccctcgtctccagtaactttcttggtaaaaaaagcttttgaaagtgttgctgttaaaaattttttggcatagaaatagagctgaatagaagagacaagatcacgagaatgaggcagccgagagtATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG1302 Uncharacterized protein conserved in bacteria ... can be seen here

    ..................................................................................................................