                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGCTGGAGTGGGCGCTGCACGTCCTTCCTCTGTTGCTTCCCTACTGGATTCTGCCC
ATGAAGTTGCTAAAAGTGCTGGGGTGGGGTACGGCTCTGCCCATATTCTAAATGAACT
ACAAAATTTACAGAGCCAGGAATTAGAAGGGTTACTCGCTTCTCAAGAAAATATTTAG
ttgagtttcaagagtctatagactgggaatttcttcccggttttttttaatttaagcagctatttttgttacattgtgatagccttgatcgcaaaattct
tattttagtagaagaggagttctctcATG

    CT795 Gene: CT795     GI: 15605529     BI number: CT795     GOG: NOG08101     Description: hypothetical protei TA A  T A  T A  T A  A G  G       at At       t  a At        cg Cg        ta Ta        gc        tt Cg        at       t  c |  t      g  g       at |  t      a  |       at T  t      a  |       gc T  c       cg        gc C  a       tg        gc G  a       ta        tg Cg        ta        cg Ta        gt        at Cg        at        gt At        gt        at                         tttttaatttaagcagctatttttgttacattgtgatagccttgatcgcaaaattcttattttagtagaagaggagttctctcATG     ..................................................................................................................