                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G=-15.10 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-14.50 kcal/mol
Anti-antiterminator:   Size=66 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATATGTACGGTTCCGTAACCGTGAATGATATGATTAGTGCTGCTGAGCAACAAGGTG
TTGTTCTTACACGTAAGAATTTCCCTCGCTCTCATAGCGGTATTAAGAATCTCGGAAG
ACACGTAGTTGGACTGAAATTAAAAGAAGGCGTGACTGCGGATCTTCATTTGGAAGTT
CGTGCTGATCACGAAATCATTGAACAAAAAGAACTCCAAAGCGCAGAAGAACAAGAAG
GTTAAactttttgtttgttgggggaagagattcttttcttccccacctcttttttttattttttaattATG

    ychB Gene: ychB     GI: 15605538     BI number: CT804     GOG: COG1947     Description: Predicted Kinas   A A  T A  C G  A C  T AT CG TA A  A       TA GC       T  A TA       G  a C  A       Gc G  A       At T  A       At G  A       Gt CG        At TA        At TA        Cg GC        At A  |       At AT        Gt GC       A  g GC       A  | TA       G  | TA       A  |       tc TA       C  |      t  t |  G      G  |       at |  C      C  |       gt |  G      G  |       at |  C      A  |       gc A  A       At        at CG        At        at TA        Cg        gc TA        Cg        gc CG        Tg        gc TA        Cg        gc                         acctcttttttttattttttaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1947 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:9 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G=-15.10 kcal/mol Antiterminator: Size=48 nt.     Delta G=-14.50 kcal/mol Anti-antiterminator:   Size=20 nt.     Delta G= -4.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AATATGTACGGTTCCGTAACCGTGAATGATATGATTAGTGCTGCTGAGCAACAAGGTG TTGTTCTTACACGTAAGAATTTCCCTCGCTCTCATAGCGGTATTAAGAATCTCGGAAG ACACGTAGTTGGACTGAAATTAAAAGAAGGCGTGACTGCGGATCTTCATTTGGAAGTT CGTGCTGATCACGAAATCATTGAACAAAAAGAACTCCAAAGCGCAGAAGAACAAGAAG GTTAAactttttgtttgttgggggaagagattcttttcttccccacctcttttttttattttttaattATG     ychB Gene: ychB     GI: 15605538     BI number: CT804     GOG: COG1947     Description: Predicted Kinas            tg           t  t           t  t            tt            tg            ct            at            Ag            Ag            Tg            Tg            Gg            Ga           A  a           A  |           G  |           A  |       tc           A  |      t  t TA       C  |       at T  A      A  |       gt G  a      A  |       at Gc       G  |       gc At        Ag        at At        Aa        at Gt        Gg        gc At        Aa        gc At        Ct        gc Cg        Gt        gc                         acctcttttttttattttttaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1947 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate synthase ... can be seen here     ..................................................................................................................