                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:182 nt.     Distance to run of Ts=2 nt.   Size=12 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-10.30 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAATTTCCGGGGCGATTGATTTAGCACGAGCTAATGTTTGTAGTCGTATTGCAGACAG
GTTTGGTGATAACGTAGTTTAGcttgatcaccttttcagtggcctaagggcctgttctttataaaaaatctttctcaaaaagca
gtcagcattgtacattccacggtctaaagctctaatgtcgtctctggagcttgtctatgggtcgttttgtctttgtgaaatcataggcagaacgcgttgt
tggaccgattatttcggtacgctagtttgtcaaaaaagtgctatttcgcaggtttgaaATG

    pmpD Gene: pmpD     GI: 15605546     BI number: CT812     GOG: NOG05022     Description: Putative Outer Membrane Protein            TT           G  T           A  A            TG   G        Gc C  T      C  t TA       A  t GT       A  g AT        Ta TG        At GC        Gc TA        Ta TG        Gc TA        Gc GC       |  t TA       |  t A  |      |  t A  |      |  t TG       |  c CG       |  a GT       |  g AT       T  t       aa GT        Tg       t  g CG        Tg        cg A  |       Gc        cg CG        Gc        gc GT        At        gc                         tgttctttataaaaaatctttctcaaaaagcagtcagcattgtacattccacggtctaaagctctaatgtcgtctctggagcttgtctatgggtcgttttgtctttgtgaaatcataggcagaacgcgttgttggaccgattatttcggtacgctagtttgtcaaaaaagtgctatttcgcaggtttgaaATG     ..................................................................................................................