                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-14.76 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGCTCTTGCTCCGGAATCCAATCGGGATATCGCTGCTGTCTCCGACGAGCAGATCT
ATATCCCCGATAGCCACGACCTTGCTGCTCCTATCTTATTCACGATAGCAGGCCAGAT
CATGGCTTACACCATGGCTTTACAGAGAGGAACCGAAGTAGATAGACCTCGGAACTTG
GCTAAATCTGTTACTGTAGAGTAAaatctacagttttttctctcttgatgaatagcataagcgtctgtatcttagatggaat
cgagaagtcgcaaatccatgcgactctctaaaaaaggtattctcATG

    tyrP_1 Gene: tyrP_1     GI: 15605552     BI number: CT817     GOG: COG0814     Description: Tyrosine Transpor            AT           G  A           A  G            TA            GC           A  C            AT            GC            CG            CG           A  A           A  A           G  |            GC            AT            GT           |  G           |  G           |  C           |  T           |  A           |  A TA       |  A T  C      |  T C  A      |  C GC       |  T GC       |  G TA       |  T A  |      |  T       AA C  |      A  A      T  a T  |       GC       G  a A  |       AT        At G  |       CG        Gc AT        AT        At CG        TA        Ta CG        TG        Gc GC        TA        Ta GT        CG        Cg AT        GT        At                         tttttctctcttgatgaatagcataagcgtctgtatcttagatggaatcgagaagtcgcaaatccatgcgactctctaaaaaaggtattctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0814 Amino acid permeases ... can be seen here     ..................................................................................................................