                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:93 nt.    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-13.20 kcal/mol
Antiterminator:    Distance from promoter:62 nt. Size=38 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:    Distance from promoter:24 nt.    Size=42 nt.     Delta G=-11.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TGTTCT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAAACTCGAAAGGAGAGAATGTTCTCCTTATGGTTTCTCAAGGAGATGTGGTGC
GATTCATCGTCTTGAAATCAGACGAGTAGtcctggccttatattttaggaagctagtctagtatggggactcaatcgag
tccctttttttttaataagagaagccttcagaaagaatatttgtgtggatataagagctctaaccatgtaggctgtctttcttattgttaggtagaaacg
aaataggggagagcaaacaacttctctattatagaagattgagtgggatATG

    CT824 Gene: CT824     GI: 15605559     BI number: CT824     GOG: COG1026     Description: Zinc Metalloprotease (insulinase family AA A  T       aa GC       g  g TA        gc T  |       at CG        ta TA        tg GC       |  t CG       |  c TA       |  t A  G       ta C  T       tg TA        at        at TG        ta       a  c At        at        cg Gc        tg        ta |  c       tg        cg C  t       cg        at G  g       cg        gc Tg       |  a       gc Gc        gc        gc Gc        gt        gt                         ttttttttaataagagaagccttcagaaagaatatttgtgtggatataagagctctaaccatgtaggctgtctttcttattgttaggtagaaacgaaataggggagagcaaacaacttctctattatagaagattgagtgggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1026 Predicted Zn-dependent peptidases, insulinase-like ... can be seen here     ..................................................................................................................