Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=51 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGACGATTATAACTATCTGGTAAATGCGATTACAGTGATGTTGAAGTACCTTTCTCC
AGGTCTAAAAAGCCCTCATTACATCAATGTCAAAGACAATTACGGAGGATCCTGGTTC
GAAAATTTATGGAGATCTAAAGGACAGGAGATTTTCTGTACGGAATTCATCAAGAGAG
TTGGGATATAGCTGACTTGAACAGCTGACCTTCACGATGTCAACGTGACGCTCTAACC
AACTGAGCTAATACCCCatgtgactcgcatcccttataaatgatgtgggatcttttttcaagaggcttATG

    ytgB_2


Gene: ytgB_2     GI: 15605565     BI number: CT830     GOG: COG0500     Description: rRNA methylase (possible


            C
          C  A
          A  A
          A  C
          T  T
           CG
           TA
           CG
           GC
          |  T
          |  A
          |  A
          |  T
          |  A
          |  C       at
          C  C      t  a
          A  C      t  a
           GC       c  a
           Ta       c  t
           Gt        cg
           Cg        ta
  T       A  |       at
G  C       At        cg
T  A       Cg        gt
A  A       Ta        cg
 GC        Gc        tg
 CG       T  |       cg
 AT        At       |  a
 CG        Gc        at
 TA        Cg        gc
                        ttttttcaagaggcttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[QR] COG0500 SAM-dependent methyltransferases ... can be seen here

    ..................................................................................................................