                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:104 nt.    Distance to gene:91 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G= -8.00 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=20 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:    Distance from promoter:49 nt.    Size=57 nt.     Delta G=-16.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTACA-TATGAC. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTACAAACGGTTTATGATCATCTTATGACAGGCTCTACAGCAAGATTACGGCTTCGT
AATCGAACAGTTTTGGTAAAAGCTAGGGGAGTAATCATAGAAAGTATATATTGAtagtgt
ttttggggctgccctagtgggttcagcagattgctgaaagaaaaacacttcttgttttttatctctataattagaggtttataaacaaaataataaaata
ttttgatatattgaataattatctgcctgtttgattagcattgtagtgagttttATG

    ftsH Gene: ftsH     GI: 15605576     BI number: CT841     GOG: COG0465     Description: ATP-dependent zinc proteas TT A  G TA At Ta A  g T  t G  g At At At Gt                   a At                 g  t Tg                 a  t A  g                 cg C  g                 gc T  |                 at A  |                 cg A  |                 ta Tg        ag        ta Gc       t  t      |  a At        cg       |  g G  g       cg       |  a Gc        cg       |  a Gc       |  t      |  a Gc       |  t      g  a At        gc       g  a Ta        ta        gc Cg        cg        ta Gt        gc        gc                         ttcttgttttttatctctataattagaggtttataaacaaaataataaaatattttgatatattgaataattatctgcctgtttgattagcattgtagtgagttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0465 ATP-dependent Zn proteases ... can be seen here     ..................................................................................................................