                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTCGTAACATTGTCTACAACTTGCCCTGATCTGCGAACTTCCATCGATACTTTTTCT
ATTGAAACCTTGATTAGTGATGTATCTGAGACAATAGCTTCTTCCTAActcaacctctttgttt
caacactacgagttcgttagtcaaaaaaaatgttactctttctcgttgattattaggtttcactaaatctcaatttgaactacacttctgcgtgacgatt
tcggggatccctcagttacaaaggactgaaagatcccttctttcaagatataaccaccaacctctttacaaacgtctcATG

    CT853 --- yhgN --- map Gene: CT853     GI: 15605589     BI number: CT853     GOG: COG2095     Description: hypothetical protein Gene: yhgN     GI: 15605588     BI number: CT852     GOG: COG2095     Description: YhgN family Gene: map     GI: 15605587     BI number: CT851     GOG: COG0024     Description: Methionine Aminopeptidas ac t  a c  c at at gc t  t t  g t  c a  g at cg                  aa ta        at       c  a |  c      g  c      a  g cg        gc        tg ta        gc        ta at        gt        gc at       c  c       at at       t  a       cg t  c      t  |       ta c  g      t  |      c  a a  |      a  |      c  a cg       g  |       cg tg        cg        ta tg        at        at ta        gt        gc gt        ta        gc gc        gc        gc                         ttctttcaagatataaccaccaacctctttacaaacgtctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG2095 Multiple antibiotic transporter ... can be seen here [U] COG2095 Multiple antibiotic transporter ... can be seen here [J] COG0024 Methionine aminopeptidase ... can be seen here     ..................................................................................................................