Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:145 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTATACAGCAGGCACAGGGGGAAGTATTCTCATCATTGGATCCGCTGCAGGTGTTGCC
TACATGGGAATGGAAAAAGTGAGTTTCGGCTGGTATGTCAAACACGCTTCTTGGATTG
CTTTAGCCAGTTATTTTGGAGGTCTAGCAGTCTATTTTCTAATGGAAAATTGTGTGAG
TTTGTTCGTCTGAggtagtcgaaaagtatggcagagtttctttaaaaattcttttaataaaagggttctctgcctattctagacccctttt
tgaatggaaaaatgggtttttggagaacatcgattATG

    CT858


Gene: CT858     GI: 15605594     BI number: CT858     GOG: NOG05144     Description: predicted Protease containing IRBP and DHR domain


 GT
A  G
A  A
A  G
 AT
 AT
 GT
 GC         G         A
 TG       C  C      T  T
|  G      A  T      T  T
A  C      C  T       GT
A  T      A  C       AT
G  G       AT        CG
G  G       AT        CG
 GT        CG       |  A
 TA        TG       |  G
 AT       G  A      G  G
 CG       T  T      A  T
 AT        AT       T  C
T  C       TG       T  T
C  A       GC        TA
C  |       GT        CG
G  |      |  T       GC
 TA       |  T       TA
 TA        TA        TG
 GC        CG        AT
 TA        GC        GC
 GC        GC        GT
                        ATTTTCTAATGGAAAATTGTGTGAGTTTGTTCGTCTGAggtagtcgaaaagtatggcagagtttctttaaaaattcttttaataaaagggttctctgcctattctagacccctttttgaatggaaaaatgggtttttggagaacatcgattATG


    ..................................................................................................................