                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -5.74 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCTTTAACAGGATCATTAGCTGTTAGAGAGCATGGTGCCTTCATTGAGAACATCGG
AGTCGAACCGCATATCGATCTGCCTTTTACAGCGAATGATATTCGCTATAAAGGCTAT
TCCGAGTATCTTGATAAGGTCAAAAAATTGGTTTGTCAGCTGATCAATAACGACGGTA
CCATTATTCTTGCGGAAGATGGTAGTTTTTAActggcgttttcgttcatagtaagagggggctttgcggatttatg
gtcccaaagcccttgttgtatttaaacattaataaatggaaaggtgatgcATG

    lytB Gene: lytB     GI: 15605595     BI number: CT859     GOG: COG0761     Description: Metalloproteas            TC           A  A AA       G  A A  A      T  T AT       C  A       TG AT       G  A      T  C CG       A  C       CG T  G       CG        TG G  T       TA        TA GT        GC       A  A AT        TG        TG A  |       TG        TA TG       |  T       AT AT        TA        CG GC        GC        CG TA        GC        AT TG        TA        TA                         GTTTTTAActggcgttttcgttcatagtaagagggggctttgcggatttatggtcccaaagcccttgttgtatttaaacattaataaatggaaaggtgatgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IM] COG0761 Penicillin tolerance protein ... can be seen here     ..................................................................................................................