                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:106 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G= -8.20 kcal/mol
Antiterminator:    Distance from promoter:29 nt. Size=42 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:    Distance from promoter:22 nt.    Size=18 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGCC-TCTAAt. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGCCTGAAGCAAAAGCTCTTTTCTAAtctaaaaatctttttaaataagaggccatcgagagatggccgctcttattt
cttactatttttcatctgctctttttataagcagcagggatattgtttttttgaaattaataaaaatttttataaaacgtttgtttttgattaattttaa
ctggaaaatcccattttcagatataattatttgtccgtttaataaattaacaatttattATG

    CT867 Gene: CT867     GI: 15605603     BI number: CT867     GOG: NOG10566     Description: Membrane Thiol Protease (predicted             t           t  c           t  t           a  t           t  a           t  c           c  t        t           t  a      t  a           c  t      t  t           g  t       ta           c  t       ta           c  t       cg            gt       |  c ag        gc        ta g  a       ta        cg cg        at        gc ta        gc        ta at        at        cg cg       |  g       tg cg        gc       a  | gc        at        cg gc        gc        ta                         tattgtttttttgaaattaataaaaatttttataaaacgtttgtttttgattaattttaactggaaaatcccattttcagatataattatttgtccgtttaataaattaacaatttattATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-17.10 kcal/mol                                                                         Nomenclature/Definitions GAAAACCTAGCCTCATTTGTCCAGGCTTGCGAAGCGGCTGTTCAGGATCTCCCAGAGC TTTTTTGGCCTGAAGCAAAAGCTCTTTTCTAAtctaaaaatctttttaaataagaggccatcgagagatggccgct cttatttcttactatttttcatctgctctttttataagcagcagggatattgtttttttgaaattaataaaaatttttataaaacgtttgtttttgatta attttaactggaaaatcccattttcagatataattatttgtccgtttaataaattaacaatttattATG     CT867 Gene: CT867     GI: 15605603     BI number: CT867     GOG: NOG10566     Description: Membrane Thiol Protease (predicted           ag          g  a           cg           ta           at           cg           cg           gc           gc          |  g          |  c           at           gc           at           at           ta             tttcttactatttttcatctgctctttttataagcagcagggatattgtttttttgaaattaataaaaatttttataaaacgtttgtttttgattaattttaactggaaaatcccattttcagatataattatttgtccgtttaataaattaacaatttattATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:158 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-17.10 kcal/mol                                                                         Nomenclature/Definitions GAAAACCTAGCCTCATTTGTCCAGGCTTGCGAAGCGGCTGTTCAGGATCTCCCAGAGC TTTTTTGGCCTGAAGCAAAAGCTCTTTTCTAAtctaaaaatctttttaaataagaggccatcgagagatggccgct cttatttcttactatttttcatctgctctttttataagcagcagggatattgtttttttgaaattaataaaaatttttataaaacgtttgtttttgatta attttaactggaaaatcccattttcagatataattatttgtccgtttaataaattaacaatttattATG     CT867 Gene: CT867     GI: 15605603     BI number: CT867     GOG: NOG10566     Description: Membrane Thiol Protease (predicted           ag          g  a           cg           ta           at           cg           cg           gc           gc          |  g          |  c           at           gc           at           at           ta             tttcttactatttttcatctgctctttttataagcagcagggatattgtttttttgaaattaataaaaatttttataaaacgtttgtttttgattaattttaactggaaaatcccattttcagatataattatttgtccgtttaataaattaacaatttattATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:214 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.80 kcal/mol Antiterminator: Size=49 nt.     Delta G=-18.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GAAAACCTAGCCTCATTTGTCCAGGCTTGCGAAGCGGCTGTTCAGGATCTCCCAGAGC TTTTTTGGCCTGAAGCAAAAGCTCTTTTCTAAtctaaaaatctttttaaataagaggccatcgagagatggccgct cttatttcttactatttttcatctgctctttttataagcagcagggatattgtttttttgaaattaataaaaatttttataaaacgtttgtttttgatta attttaactggaaaatcccattttcagatataattatttgtccgtttaataaattaacaatttattATG     CT867 Gene: CT867     GI: 15605603     BI number: CT867     GOG: NOG10566     Description: Membrane Thiol Protease (predicted TC A  T GC GC A  | C  | T  | T  | GC TA CG G  A        G G  |      T  A CG       C  A GC        CG AT        GC AT       G  | GT       T  | C  T      T  | G  T       TA T  T       TA TG        TA CG        TA GC        CG GC        GC AT        AT CG        GC             TTTTCTAAtctaaaaatctttttaaataagaggccatcgagagatggccgctcttatttcttactatttttcatctgctctttttataagcagcagggatattgtttttttgaaattaataaaaatttttataaaacgtttgtttttgattaattttaactggaaaatcccattttcagatataattatttgtccgtttaataaattaacaatttattATG     ..................................................................................................................