                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:108 nt.    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-16.00 kcal/mol
Antiterminator:    Distance from promoter:79 nt. Size=33 nt.     Delta G= -5.63 kcal/mol
Anti-antiterminator:    Distance from promoter:32 nt.    Size=54 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-aaaaat. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacttaaaaagtttggggacaaaaaataaagatctcaaatggttttgtgtttcaaggccataggtctttttttttttttgaacacaaagtatgatttc
taagagaatgtctgttatcaacattcttttctaaacaggcgtggaagccgaagccaagcttttttttcacgccttctttaatgcttcgaaaaatattgaa
aatctgttagtctagttgagccctcgtgtagtcctacacaatgacattagatacgcagaggttgggcgtttATG

    CCA00050 --- CCA00051 --- CCA00052 --- b1680 Gene: CCA00050     GI: 29839818     BI number: CCA00050     GOG: COG0719     Description: conserved hypothetical protein Gene: CCA00051     GI: 29839819     BI number: CCA00051     GOG: COG0396     Description: ABC transporter, ATP-binding protein Gene: CCA00052     GI: 29839820     BI number: CCA00052     GOG: COG0719     Description: conserved hypothetical protein Gene: b1680     GI: 29839821     BI number: CCA00053     GOG: COG0520     Description: aminotransferase, class   a c  a a  a cg at a  a gt tg ta |  t                  a t  t                c  a t  t        t        cg t  c      t  c       gc t  t      a  t       at ta       c  t       at ta       a  t       gt tg       a  t      c  t ta       c  c      c  | tg       t  t       gt ta       a  a       at ta        ta        at c  t       ta        gt t  g       gc        gc gt        ta        ta gc        cg        gc at        tg        cg tg        gc        gc at        tg        gc                         ttctttaatgcttcgaaaaatattgaaaatctgttagtctagttgagccctcgtgtagtcctacacaatgacattagatacgcagaggttgggcgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [E] COG0520 Selenocysteine lyase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:188 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -8.50 kcal/mol Antiterminator: Size=49 nt.     Delta G= -5.74 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgagccctcatgaggtcaaaaaattgctttgacttaaaaagtttggggacaaaaaataaagatctcaaatggttttgtgtttcaaggccataggtcttt ttttttttttgaacacaaagtatgatttctaagagaatgtctgttatcaacattcttttctaaacaggcgtggaagccgaagccaagcttttttttcacg ccttctttaatgcttcgaaaaatattgaaaatctgttagtctagttgagccctcgtgtagtcctacacaatgacattagatacgcagaggttgggcgttt ATG     CCA00050 --- CCA00051 --- CCA00052 --- b1680 Gene: CCA00050     GI: 29839818     BI number: CCA00050     GOG: COG0719     Description: conserved hypothetical protein Gene: CCA00051     GI: 29839819     BI number: CCA00051     GOG: COG0396     Description: ABC transporter, ATP-binding protein Gene: CCA00052     GI: 29839820     BI number: CCA00052     GOG: COG0719     Description: conserved hypothetical protein Gene: b1680     GI: 29839821     BI number: CCA00053     GOG: COG0520     Description: aminotransferase, class aa a  t a  a a  a a  a c  g a  a gt gc gt gc ta ta ta         t gt       g  t |  g      t  t a  g       gc at        ta at        ta at        tg at        tg tg        gc t  t       gc cg        ta at        at             aggtctttttttttttttgaacacaaagtatgatttctaagagaatgtctgttatcaacattcttttctaaacaggcgtggaagccgaagccaagcttttttttcacgccttctttaatgcttcgaaaaatattgaaaatctgttagtctagttgagccctcgtgtagtcctacacaatgacattagatacgcagaggttgggcgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [E] COG0520 Selenocysteine lyase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:198 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-13.80 kcal/mol Antiterminator: Size=49 nt.     Delta G= -5.74 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgagccctcatgaggtcaaaaaattgctttgacttaaaaagtttggggacaaaaaataaagatctcaaatggttttgtgtttcaaggccataggtcttt ttttttttttgaacacaaagtatgatttctaagagaatgtctgttatcaacattcttttctaaacaggcgtggaagccgaagccaagcttttttttcacg ccttctttaatgcttcgaaaaatattgaaaatctgttagtctagttgagccctcgtgtagtcctacacaatgacattagatacgcagaggttgggcgttt ATG     CCA00050 --- CCA00051 --- CCA00052 --- b1680 Gene: CCA00050     GI: 29839818     BI number: CCA00050     GOG: COG0719     Description: conserved hypothetical protein Gene: CCA00051     GI: 29839819     BI number: CCA00051     GOG: COG0396     Description: ABC transporter, ATP-binding protein Gene: CCA00052     GI: 29839820     BI number: CCA00052     GOG: COG0719     Description: conserved hypothetical protein Gene: b1680     GI: 29839821     BI number: CCA00053     GOG: COG0520     Description: aminotransferase, class aa a  t a  a a  a a  a        t c  g      g  t a  a      t  t gt        gc gc        ta gt        ta gc        tg ta        tg ta        gc ta        gc gt        ta |  g       at a  g      a  | at       a  | at       c  | at        ta at        cg tg        tg t  t       at cg        gc at        at             ttttttttttttgaacacaaagtatgatttctaagagaatgtctgttatcaacattcttttctaaacaggcgtggaagccgaagccaagcttttttttcacgccttctttaatgcttcgaaaaatattgaaaatctgttagtctagttgagccctcgtgtagtcctacacaatgacattagatacgcagaggttgggcgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [E] COG0520 Selenocysteine lyase ... can be seen here     ..................................................................................................................