Gene putatively regulated by attenuation in C_caviae
Characteristics of the secondary structures
Terminator: Distance from promoter:77 nt. Distance to gene:0 nt. Distance to run of Ts=0 nt. Size=32 nt. Delta G= -9.20 kcal/mol
Antiterminator: Distance from promoter:45 nt. Size=49 nt. Delta G= -3.76 kcal/mol
Anti-antiterminator: Distance from promoter:19 nt. Size=54 nt. Delta G= -9.15 kcal/mol
Nomenclature/Definitions
The most likely promoter is: atgaag-tatcat. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
atgaagctatgataacaaaacgttatcatagaaaagaaaaagagaatttgtcaaatccgttgtttttgttttgtttacaaaatataatttttttgtttga
taaaacacttttttatttagtaaaataaataaaaaggttttttATG
CCA00072
Gene: CCA00072 GI: 29839840 BI number: CCA00072 GOG: NOG04994 Description: conserved hypothetical protei
tt
t a at
gc g a
ta ta
ta ta
ta ta
ta gc
gt ta
ta t c
t t t t
t a t t
t a t t aa
t t t t t a
g t t t g a
t t a | at
t t a | ta
g t t | ta
c t at ta
c t ta at
tg at ta
at at ta
at at ta
at a a ta
cg cg ta
ta at tg
gt ta cg
ta ta at
tttttATG
..................................................................................................................