Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:201 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-14.30 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaggaaagatgactgagtggtcgaaagtacgtccctgctaaggacgcgtacccctaaagggtaccgagggttcgaatccctctctttccgaattttctaa
cggagcccgtaataaagttaattggttgctctttttctttaaaatttttctaaaatatcaaataggtatcaatataaggtgatctaagaaagggttattg
gagaggaggaactctcttcttgcctgtagaatcggcttattctataataggccctttaggttatattaagattccttaaaagatcacgttagccaaaatc
ATG

    CCA00125


Gene: CCA00125     GI: 29839893     BI number: CCA00125     GOG: COG0558     Description: CDP-alcohol phosphatidyltransferas


            a
          t  a
          c  a
           cg
           cg
           cg
           at
           ta
           gc
          c  |
           gc
           cg
          a  |        g
          g  |      c  a
          g  |      t  a
          a  |      t  t
  c       a  |       gc
g  t      t  |       gc
t  a      c  |       gc
c  a      g  |       at
 cg        ta        gc
 cg        cg       c  t
 ta        cg       c  c
 gc        cg       a  t
 cg       |  t      t  t
 Gc       t  t       gt
 Tg        gc        gc
 At        cg        gc
                        gaattttctaacggagcccgtaataaagttaattggttgctctttttctttaaaatttttctaaaatatcaaataggtatcaatataaggtgatctaagaaagggttattggagaggaggaactctcttcttgcctgtagaatcggcttattctataataggccctttaggttatattaagattccttaaaagatcacgttagccaaaatcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[I] COG0558 Phosphatidylglycerophosphate synthase ... can be seen here

    ..................................................................................................................