                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGTCTTAATGTGATTGCTGTAGTGCTTCTTTTAATTATGGTTGTTTGGATCGCTGT
TGTCGCTTTCATAGGAAGAGAGTACAACATCAAAGAAGCTAGTGCTGTTGCGGAAAGT
TCGAAAGCAGATGCAATCGCATCGAATGCCACTATCAGCAGGACTACAGTAGAAAATT
CCAACAAAGAAGAAGTTGCTACGCTATAGtttaaagggctttatagccctttttatcatatttttttgatctttaagcc
ctccctcacatactttattttataaatttttgactttacgggtgtttATG

   ف --- CCA00127 --- polA --- CCA00129 Gene: CCA00127     GI: 29839895     BI number: CCA00127     GOG: COG0616     Description: protease IV, putative Gene: polA     GI: 29839896     BI number: CCA00128     GOG: COG0258,COG0749     Description: DNA polymerase I Gene: CCA00129     GI: 29839897     BI number: CCA00129     GOG: COG0237     Description: kinase, putative Gene: rho     GI: 29839898     BI number: CCA00130     GOG: COG1158     Description: transcription termination factor Rh AA C  A A  G A  A C  A CG TA TA A  G A  T A  T A  G GC AT TA GC |  G |  C A  T C  A AT TA CG At Gt Gt A  a C  a G  | A  | C  | T  |       ta A  |      t  t Ta        ta Cg        cg A  |       gc Cg        gc Cg        gc Gc        at             ttttatcatatttttttgatctttaagccctccctcacatactttattttataaatttttgactttacgggtgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OU] COG0616 Periplasmic serine proteases (ClpP class) ... can be seen here [L] COG0258 5'-3' exonuclease (including N-terminal domain of PolI) ... can be seen here [L] COG0749 DNA polymerase I - 3'-5' exonuclease and polymerase domains ... can be seen here [H] COG0237 Dephospho-CoA kinase ... can be seen here [K] COG1158 Transcription termination factor ... can be seen here     ..................................................................................................................