Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:159 nt.    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -7.90 kcal/mol
Antiterminator:    Distance from promoter:139 nt. Size=35 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:    Distance from promoter:96 nt.    Size=50 nt.     Delta G= -5.45 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgagt-taagct. It has a score value of 78.98 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgagtttcagaggaacttctgttaagctttcctttcttaaaggtctcagatccctgaaaaagggctgccttaggcaccgatagctcaatcggatagagt
acctggcttcgaaccaggtggttagaggttcgagccctcttcggtgcgttaaaaactttttagaataaagagcttccttcttataatacagataggagaa
tctctttccttttttctgattttttcatctccgagtgttgtataaattttttcaccataaggagacggcATG

    CCA00154 --- CCA00153 --- CCA00152


Gene: CCA00154     GI: 29839922     BI number: CCA00154     GOG: COG1544     Description: conserved hypothetical protein
Gene: CCA00153     GI: 29839921     BI number: CCA00153     GOG: NOG07061     Description: conserved hypothetical protein
Gene: CCA00152     GI: 29839920     BI number: CCA00152     GOG: COG1381     Description: conserved hypothetical protei


  t
c  t
t  c
 cg
 cg
|  t
 cg
 gc
|  g
|  t
|  t
|  a
|  a
|  a
|  a
|  a
|  c
|  t
|  t       aa
|  t      t  t        c
|  t      a  a      t  t
|  t      t  c      a  c
|  a       ta        at
|  g       cg        gt
|  a       ta        at
|  a      |  t       gc
|  t       ta        gc
|  a       cg        at
a  a       cg       |  t
g  a       ta       |  t
 cg        tg       |  t
 ta       c  a      t  t
 tg       g  a       at
 gc        at        gc
 gt        gc        at
 at        at        cg
                        attttttcatctccgagtgttgtataaattttttcaccataaggagacggcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG1544 Ribosome-associated protein Y (PSrp-1) ... can be seen here
[L] COG1381 Recombinational DNA repair protein (RecF pathway) ... can be seen here

    ..................................................................................................................