                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAGCTATAGAGATGCTTTACGATCTAGAAAATGCCCAGCCTGTGAGGGTGCCCCCAT
CTCCCCTATCTTAAgagatttcccttgcgcttattagaaaagaacacgtacattgtaagcacactttgtgccggcgtggcggaatggtag
acgcggtagactcaaaatctactcttagcaataaggtgttggttcgagtccaatcgccggcataagttttttttctcagttttttcaggttgctaataaa
ttcgttagtagttttttttaagaaaagctacatgccgaaccctttgcttcctATG

    CCA00158 --- CCA00157 Gene: CCA00158     GI: 29839926     BI number: CCA00158     GOG: NOG07060     Description: conserved hypothetical protein Gene: CCA00157     GI: 29839925     BI number: CCA00157     GOG: COG0642,COG2202     Description: sensor histidine kinas ca g  a at ta ta cg tg |  t       cc cg       t  a at       g  a t  t       at cg        gc tg        cg at       t  | at       t  | a  c       gc a  |       gc cg        tg ta        tg cg        gc at        ta gc        gt             aagttttttttctcagttttttcaggttgctaataaattcgttagtagttttttttaagaaaagctacatgccgaaccctttgcttcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here [T] COG2202 FOG: PAS/PAC domain ... can be seen here     ..................................................................................................................