Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:163 nt.    Distance to gene:37 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G= -7.50 kcal/mol
Antiterminator:    Distance from promoter:102 nt. Size=71 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:    Distance from promoter:82 nt.    Size=53 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcaga-taacat. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcagaatacatattttctttcgtaacatcttatgaaaggaaataacctaggaatctccatagttgtagcgcagttcttcggaaggtttttgatgggttt
tttaccgcattgtaagggtgatcaaagataattcttgatagtttttattttaaaacattcttactaataagaagcatttaatttaaaatagcggaatagg
aacattttctttgttttattccatattttttttaaaatgtccacttttaactcccatatttgcagcagatATG

    CCA00180


Gene: CCA00180     GI: 29839947     BI number: CCA00180     GOG: NOG39222     Description: conserved hypothetical protei


           ta
          c  a
           at
           ta
           ta
           cg
           ta
           ta
          a  g
          c  c
 ga       a  a
t  t       at
 ta        at
 cg        at
|  t       ta
t  t       ta
t  t      t  t
 at       t  t
 at        at
 ta        ta
 at        ta
 gt        ta         t
 at        ta       t  c
 at       |  t      t  t
a  a      |  a      t  t
c  a       tg        at
t  a       gc        cg
a  a      |  g       at
 gc       a  g       at
 ta       t  a      g  |
 gt       a  a       gt
 gt        gt        at
 gc        ta        ta
 at        tg        at
 at        cg        at
 ta        ta        gc
 gc        ta        gc
                        atattttttttaaaatgtccacttttaactcccatatttgcagcagatATG


    ..................................................................................................................