Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:23 nt.    Distance to gene:105 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-14.30 kcal/mol
Antiterminator:    Distance from promoter:21 nt. Size=20 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-tagatt. It has a score value of 74.3 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatattctgtttatatgcagatagattagatctgcgtgtaaatttccatagaagctctgtagcttttactagggatacagagttttttctttgcccgc
ctctaattcggtaatcgaggtgcctagagaggatttctcttgaagaaataactaggttcgaggtatcaagtctctttcgtcttaggattaaaaaagaAT
G

    gltX


Gene: gltX     GI: 29839949     BI number: CCA00182     GOG: COG0008     Description: glutamyl-tRNA synthetas


  t
a  t
g  a
a  g
 ta
 at
 gc
 at
 cg
 gc
 tg
 at
 tg
 at
 ta                  ac
 ta                 t  t
|  a                 ta
|  t                 tg
|  t                 tg
|  t                 cg
|  c                g  a
|  c                 at
 ta        tg        ta
 gt       c  t       gc
 ta        ta        ta
 cg        cg        cg
 ta        gc        ta
 ta        at        cg
a  g       at        gt
t  c       gt        at
 at        at        at
 gc        ta        gt
                        ttctttgcccgcctctaattcggtaatcgaggtgcctagagaggatttctcttgaagaaataactaggttcgaggtatcaagtctctttcgtcttaggattaaaaaagaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0008 Glutamyl- and glutaminyl-tRNA synthetases ... can be seen here

    ..................................................................................................................