Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:214 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTTGCTTTGATTTTATCTGGATTAAGTTTCCTTCCTCAAGCAACACTACCTTTTTC
AGGAGCCTACTTTATTATAGGTTCTTTCTTGGTTTTCATTGCAGCCGGAATATTATTG
ATCAATACACTTTGCGATGCGTGCGACGTATTACGTCCCTTCGCTCCGCTATCTTAAa
aagaatattttttttaccaacctgtttattctaaatagtttttttttggagaccaaaaatcttcgctcaagcctgaggattttgtgtcgatgttacgagt
atccgtgatcaacaaagatatttgtaATG

    CCA00187


Gene: CCA00187     GI: 29839954     BI number: CCA00187     GOG: COG0793     Description: tail-specific protease precursor, putativ


 CT
A  A
C  C
A  C
A  T
C  T
 GT
 AT
 AT
C  C
 TA
 CG
 CG        TA
 TA       T  T
 TG       T  T
C  C      C  A
C  C       AT
T  T       TA
T  |       CG
 TA        CG
 GC        GT
 AT        AT
 AT        GC
            TTTCTTGGTTTTCATTGCAGCCGGAATATTATTGATCAATACACTTTGCGATGCGTGCGACGTATTACGTCCCTTCGCTCCGCTATCTTAAaaagaatattttttttaccaacctgtttattctaaatagtttttttttggagaccaaaaatcttcgctcaagcctgaggattttgtgtcgatgttacgagtatccgtgatcaacaaagatatttgtaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0793 Periplasmic protease ... can be seen here

    ..................................................................................................................