                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G=-12.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTTTAATCGCATTTGCCTCTGGCGCATTTCTCGAATCTATAACCTTTAATTCCCCA
TGATTGCAAAAAGGACACTGCATgggagctacctcctaaagttaaggtagtctaagaaaataataattttaacgcaggataaa
tctatgcgactataagttgcaaattttttttcctaatccataaaaatagggcttgcgacagatgcggatagcgtgataagttctcgccatttttgcgaaa
gtgcaacatcttatcgcaagggtattttattgtaaatattagttgtttagggattaagaATG

    ribE --- CCA00214 --- CCA00215 Gene: ribE     GI: 29839980     BI number: CCA00213     GOG: COG0307     Description: riboflavin synthase, alpha subunit Gene: CCA00214     GI: 29839981     BI number: CCA00214     GOG: COG1092     Description: conserved hypothetical protein Gene: CCA00215     GI: 29839982     BI number: CCA00215     GOG: COG0566     Description: spoU rRNA methylase family protei   t a  a c  a c  a t  a a  a at ta cg cg tg t  c t  | t  | t  | t  | t  | t  | a  | at at cg         a gc       a  g       aa tg       t  t      c  c ta        at       g  a gc        gc       t  t a  a      t  t       gc a  g       gc        at ta        cg        at at        gc       |  a tg       |  c       at c  |      |  a       gc a  |      a  t       cg gc       t  t       gc cg        at        ta g  g       gt        ta ta        gt        tg at        cg        tg ta        gc        tg cg        tg        at                         attttattgtaaatattagttgtttagggattaagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [R] COG1092 Predicted SAM-dependent methyltransferases ... can be seen here [J] COG0566 rRNA methylases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:128 nt.     Distance to run of Ts=1 nt.   Size=17 nt.     Delta G= -6.00 kcal/mol Antiterminator: Size=19 nt.     Delta G= -3.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCGTTTAATCGCATTTGCCTCTGGCGCATTTCTCGAATCTATAACCTTTAATTCCCCA TGATTGCAAAAAGGACACTGCATgggagctacctcctaaagttaaggtagtctaagaaaataataattttaacgcaggataaa tctatgcgactataagttgcaaattttttttcctaatccataaaaatagggcttgcgacagatgcggatagcgtgataagttctcgccatttttgcgaaa gtgcaacatcttatcgcaagggtattttattgtaaatattagttgtttagggattaagaATG     ribE --- CCA00214 --- CCA00215 Gene: ribE     GI: 29839980     BI number: CCA00213     GOG: COG0307     Description: riboflavin synthase, alpha subunit Gene: CCA00214     GI: 29839981     BI number: CCA00214     GOG: COG1092     Description: conserved hypothetical protein Gene: CCA00215     GI: 29839982     BI number: CCA00215     GOG: COG0566     Description: spoU rRNA methylase family protei aa t  a        t at       a  a gc       t  a gt        cg |  a       at at        gt cg        cg gc        gc cg        ta             aattttttttcctaatccataaaaatagggcttgcgacagatgcggatagcgtgataagttctcgccatttttgcgaaagtgcaacatcttatcgcaagggtattttattgtaaatattagttgtttagggattaagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [R] COG1092 Predicted SAM-dependent methyltransferases ... can be seen here [J] COG0566 rRNA methylases ... can be seen here     ..................................................................................................................