                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=53 nt.     Delta G= -7.34 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaatcctagtttaggtagtgggggattgtttcgcatctagaaaacagttttcatctttatttgtaatagaaacagtgtagatacatcattaaaaacactt
atttttagcagtgtttaggttatatgatgagccgattgacatttttcgatgtggcagctaggatgtctttttctggatcttagctttttctccaagggaa
aaatgacagtagttcttaggctttcttgggttaagtgcggagagcttcgctttatattataatttttcgtttgtagatagttgttaacagaggttcggca
ATG

    glyA --- clpP --- 2 Gene: glyA     GI: 29839991     BI number: CCA00224     GOG: COG0112     Description: serine hydroxymethyltransferase Gene: clpP-2     GI: 29839992     BI number: CCA00225     GOG: COG0740     Description: ATP-dependent Clp protease, proteolytic subunit Gene: dapF     GI: 29839993     BI number: CCA00226     GOG: COG0253     Description: diaminopimelate epimeras            tt           a  t tt       c  t t  t       at t  a       gc a  g       tg t  c       ta ta        at cg       |  g at        gt cg        cg at        cg         t at        gc       t  t at       a  a      t  c |  a      g  g      t  t |  g      t  c       cg |  g      a  t       tg at       g  a      g  | at       t  g       ta ta       a  g       at |  t       ta        gc ta        at        gt at        tg        at cg       t  t       ta ta        gc        cg at        gt        gc cg        at        at                         ttttctccaagggaaaaatgacagtagttcttaggctttcttgggttaagtgcggagagcttcgctttatattataatttttcgtttgtagatagttgttaacagaggttcggcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0112 Glycine/serine hydroxymethyltransferase ... can be seen here [OU] COG0740 Protease subunit of ATP-dependent Clp proteases ... can be seen here [E] COG0253 Diaminopimelate epimerase ... can be seen here     ..................................................................................................................