                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-12.05 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGGTGGTCCCAATATCAATACAGAAGATTTGAAAAAACATAGCTTCAGCACAAAGC
CACCTGCAGGAAATTCAGCTTCTTCAAACTCGAACAATGAGAACATCGAGGAAGCGGA
TGTTGAAATCGTAGATAAACCTAACGATTAAtatcctaaaaaacttatcttttattccctatttctctccggagaat
agggaattttctttttaaccctattcataaaaatatctttgcattaaaaacatccaacaaaggctaggtaaacccatgaaaatcataattccagacgtgg
agcaaagTTG

    CCA00240 --- CCA00239 Gene: CCA00240     GI: 29840007     BI number: CCA00240     GOG: COG0557     Description: exoribonuclease, VacB/Rnb family Gene: CCA00239     GI: 29840006     BI number: CCA00239     GOG: COG2094     Description: DNA-3-methyladenine glycosylas            AA           T  A           A  C            GC            AT           |  A            TA            GC            CG            TA           A  |           A  |            AT            GT            TA            TA            Gt            Ta            At            Gc            Gc           |  t   C       |  a A  A      |  a A  A      |  a GT       |  a CG       |  a TA       |  a       cc CG       |  c      t  g |  A      |  t       cg |  A      |  t       ta |  C      |  a       cg A  A      |  t      t  | A  T      |  c       ta A  C      |  t       ta CG       |  t       at TA       |  t       ta TG       C  t       cg CG       G  a       cg TA        At        cg TA        At        ta CG        Gc        ta GC        Gc        at                         tttctttttaaccctattcataaaaatatctttgcattaaaaacatccaacaaaggctaggtaaacccatgaaaatcataattccagacgtggagcaaagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0557 Exoribonuclease R ... can be seen here [L] COG2094 3-methyladenine DNA glycosylase ... can be seen here     ..................................................................................................................