                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-16.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAGTCAGTCCTGAAAAGTTCATATTCCCCAGAGCTAAGGTCGGTGGTGATGGGACCA
CGAAAACCGAGGCACCAAGAAAATCTGAGCGTTTAGAGGGGAAGAAAAATAAGGGAAT
TCTTAAACAACCTGGAAAACCTAAAACAGGGGATAAGGGAGTGCGTTGGGCCGATCAG
GAGAACAAGCCTCTTGAATAAtcagctctggcgtttggttagattttcattttgtaaaacagctgcatcttaaaagatgcggctt
tttttatataaaaatcccacccagttcactggagtaactggATG

    CCA00251 Gene: CCA00251     GI: 29840018     BI number: CCA00251     GOG: -------     Description: hypothetical protei   A C  A A  G A  C GC AT        ga GC       a  t GT       t  t AT       t  t CG        gt TA        gc |  A       ta |  T      |  t |  A      t  t |  A      t  t At        gt Gc        cg        aa C  a       gt       t  a Cg       |  a       ta Gc       |  a       cg |  t      g  a       ta Gc       t  a       at Gt       c  c       cg Tg        ta        gc Tg        cg        tg Gc        gc        cg Cg        at        gc Gt        cg        at                         ttttttatataaaaatcccacccagttcactggagtaactggATG     ..................................................................................................................