                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:151 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGAAGTTCAAAAGGCTTTGGATGAGCTGCAAGCAGAGGGAGTAGTCCGAGAATTAG
AAAAGAAATGGGGCTTAGATCAAAAGAAGTTTTAAcatttcttttattaagaagaatcttcctattagaagata
cttcttgtctatttttgcatttttcttttttaaattgtctttagacttcttttttaaatttcttttcttatataagaattaatttgtttgagtttttata
aactcttacaatttgatcttttctattttttttgttattttctttctgattattttaaggggctgtgtATG

    CCA00263 --- CCA00264 --- CCA00265 Gene: CCA00263     GI: 29840030     BI number: CCA00263     GOG: NOG08095     Description: conserved hypothetical protein Gene: CCA00264     GI: 29840031     BI number: CCA00264     GOG: COG1235     Description: metal-dependent hydrolase, putative Gene: CCA00265     GI: 29840032     BI number: CCA00265     GOG: COG2262     Description: GTP-binding protein HflX, putativ CA T  A A  A G  A A  G TA TA CG GT GT |  T |  T |  A G  A Gc Ta At At At Gc At At At        at At       t  t |  a      c  a Gt        cg At        ta Ta        ta Ta        cg |  g       ta |  a       at |  a      a  a |  g       gc |  a       at A  a       at At        gc Gc        at At        at Gt        tg             tctatttttgcatttttcttttttaaattgtctttagacttcttttttaaatttcttttcttatataagaattaatttgtttgagtttttataaactcttacaatttgatcttttctattttttttgttattttctttctgattattttaaggggctgtgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1235 Metal-dependent hydrolases of the beta-lactamase superfamily I ... can be seen here [R] COG2262 GTPases ... can be seen here     ..................................................................................................................