Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGGAAACAAAGGCTACCAACCTAGCTCGTCATGCATTTGTAGTTCGTGCTGCAAATA
ACTTTACCTATTCAGAACACATAGAGTTATTTGGACACGGTGGATTCGAACTTCGCGG
ATCTGCATATAGCTACAACTTCGATCTTGGTGGAAAAATCCTCTTCTAAgatttttgtagactc
cctgctgaatttacacagggagtcttctccttattttctacatcaatatacagcaactcttgctttattttctgatttttcttatgtcatgtagagccgc
aaaatatgcagggaatactaATG

    CCA00281


Gene: CCA00281     GI: 29840048     BI number: CCA00281     GOG: -------     Description: polymorphic outer membrane protein G family protein/autotransporter, putativ


            A
          T  T
          A  A
           CG
           GC
          |  T
          |  A
          |  C
          |  A
          |  A
          |  C       AA
          |  T      A  A
          |  T       AT
  T       T  C       GC
C  T       CG        GC
A  C       TA       |  T
A  G       AT       |  C
 GC        GC       |  T
 CG        GT       T  T
 TG       |  T       GC
 TA       |  G       GT
 AT        CG        TA
 GC        GT        TA
 GT        CG        Cg
 TG        TG        Ta
 GC        TA        At
                        ttttgtagactccctgctgaatttacacagggagtcttctccttattttctacatcaatatacagcaactcttgctttattttctgatttttcttatgtcatgtagagccgcaaaatatgcagggaatactaATG


    ..................................................................................................................