Gene putatively regulated by attenuation in C_caviae
Characteristics of the secondary structures
Terminator: Distance from promoter:39 nt. Distance to gene:97 nt. Distance to run of Ts=2 nt. Size=20 nt. Delta G= -9.00 kcal/mol
Antiterminator: Distance from promoter:27 nt. Size=23 nt. Delta G= -9.80 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TAGATT-TAAtat. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TAGATTCTCTTAATCAAAAGAGTTAAtattatttatccgaaacaagccttacagcatcctctctgtccccctgagaggatg
cttagggcccttttttatttcttttcgacatcttcaaaacattatcgatacgcgtatataaaaaatgtttcttcctaaaggcaggctctgtaaaataaaa
caattttttttagagtgttgccATG
CCA00300
Gene: CCA00300 GI: 29840065 BI number: CCA00300 GOG: NOG44056 Description: conserved hypothetical protei
c
c c
t c ga
g c g t
t t a g
cg gc
ta at
cg gt
ta ta
cg cg
cg cg
ta cg
cccttttttatttcttttcgacatcttcaaaacattatcgatacgcgtatataaaaaatgtttcttcctaaaggcaggctctgtaaaataaaacaattttttttagagtgttgccATG
..................................................................................................................