                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=3 nt.   Size=26 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -8.40 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -4.59 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATGGATTCGCAGCAAGCACTTAATGTTGTAAATGCTGGAGCTATACCCACTAGGGAT
GCAGGAGAAATTTCTTTAACGAAAGGGCAAAAAATCGATAAAAAGTCTTTAGCTTCCT
TAGCTGTCTTATGCATTTTCCAATTACCAAAAACATAACTCTTGCGTTCCATctatgccct
caaattgttttaactcttatgtcttactatagacattgattcacgattcttgctagttttctgctaagtaaggtactttattcttcaaataaataaaaat
tgaaacctcctggatctaaggatATG

    xseA --- xseB --- CCA00305 --- dxs Gene: xseA     GI: 29840072     BI number: CCA00307     GOG: COG1570     Description: exodeoxyribonuclease, large subunit Gene: xseB     GI: 29840071     BI number: CCA00306     GOG: COG1722     Description: exodeoxyribonuclease VII, small subunit Gene: CCA00305     GI: 29840070     BI number: CCA00305     GOG: NOG08784     Description: conserved hypothetical protein Gene: dxs     GI: 29840069     BI number: CCA00304     GOG: COG1154     Description: deoxyxylulose-5-phosphate synthas            ct           a  a           t  t            ta            cg            ta            gc            ta            at           t  t           t  |            cg            ta           c  t   A       a  t C  T      a  c C  c      t  | T  t      t  | Ta       t  | Gt        ta Cg        gc Gc        tg T  c       ta         t T  c       at       t  c C  t       at       t  t T  c      a  c       tg C  a      c  t       gc A  a      t  t       at A  a      c  |      |  a T  t      c  |       ta At        cg        cg Cg        gc        gt At       t  |       ta At        at        ta At        ta        cg At        cg        tg                         tactttattcttcaaataaataaaaattgaaacctcctggatctaaggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1570 Exonuclease VII, large subunit ... can be seen here [L] COG1722 Exonuclease VII small subunit ... can be seen here [HI] COG1154 Deoxyxylulose-5-phosphate synthase ... can be seen here     ..................................................................................................................