                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:174 nt.    Distance to gene:10 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G=-14.60 kcal/mol
Antiterminator:    Distance from promoter:138 nt. Size=50 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:    Distance from promoter:143 nt.    Size=18 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACG-TAGAGT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACGAAGCAAATAACCACTTGGATCTAGAGTCTGTTTCTGCATTAGCTTGGGCGAT
TAATGATTATAAAGGCACCTCTATCTTTGTTTCTCACGACAGAACGTTAATTGAAGAG
TGTGCCACGAAATTGCTTATCTTTGATAAAGGCAAAATTACTTTCTTTGATGGGACTA
TGGCTGACTATACAAGCAGCAGCAAGTTATAGacccaagctgcgtggcagtttgggagatgttttactgaggtcat
ATG

    maf --- CCA00313 --- CCA00312 Gene: maf     GI: 29840079     BI number: CCA00314     GOG: COG0424     Description: MAF protein Gene: CCA00313     GI: 29840078     BI number: CCA00313     GOG: COG1413     Description: conserved hypothetical protein Gene: CCA00312     GI: 29840077     BI number: CCA00312     GOG: NOG04296     Description: conserved hypothetical protei            GC           A  A            CG            GC           A  A           A  A            CG            AT           |  T            TA            AT            TA            CG           |  a           |  c           |  c           A  c        t           G  a      g  g   A        Ta        cg T  C       Cg        gc A  A       Gc        ta TA       |  t       cg CG       |  g       gt A  |       Gc        at GC        Tg        at TA        At        cg CG        Tg        cg GC        Cg        cg                         agatgttttactgaggtcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG0424 Nucleotide-binding protein implicated in inhibition of septum formation ... can be seen here [C] COG1413 FOG: HEAT repeat ... can be seen here     ..................................................................................................................