                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tctattgagcctgaatgcaaaacgcaagaaccttctgcattcctagctttcttaatgtcgggattttaagaagtataggagatttaactctcttccttat
gctaggaatcgttatgtacctaattctaaaaattttaagaaaaatttgcgtttttatgtgagtatacgcaaaaatgcgcttactcactttttcccagcaa
attacggaaacaaaatctatcttaaataaagagaaaaaaccgccttaggcacaagcctaggccatttgataatcaatttttaaaatcaggtaattttctt
ATG

    CCA00337 Gene: CCA00337     GI: 29840101     BI number: CCA00337     GOG: -------     Description: hypothetical protei tg        aa g  a      a  a tg        at at        cg ta        gc t  t       cg t  |      a  c t  |      t  t ta        at gc        ta cg        gc gc        at ta        gc ta        ta ta        gc             tttttcccagcaaattacggaaacaaaatctatcttaaataaagagaaaaaaccgccttaggcacaagcctaggccatttgataatcaatttttaaaatcaggtaattttcttATG     ..................................................................................................................