                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:38 nt.    Distance to gene:161 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -6.00 kcal/mol
Antiterminator:    Distance from promoter:22 nt. Size=28 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-14.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCGAAA-TACTCT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGAAAGAGAAGAAGATTGTCAGCTACTCTTATCTTTATCGGGAGATAGGGTAGGGCA
GGGAGTATTTTTCGTTGGACCTTATCCTACGGATCTTTATTTCCCAGAATCAGGGGAA
ACAGCTCTTCTGCTTGTCTTCTCTTCTGCGGGGATCCCTATTTCTTAAagacatttccctcttt
tagataaatatacgaaattgtttgcctagagctatttttatgttatgacggcataagagcgatttgtttgtaggaacttttATG

    CCA00344 Gene: CCA00344     GI: 29840108     BI number: CCA00344     GOG: COG1109     Description: phosphoglucomutase/phosphomannomutase family protei TC A  G TG TG TA CG TA AT TA         T TG       A  T CG       T  T T  |       GT         T CG        AT       C  T AT        GC       C  A TA       G  G       AT CG        GT        GC G  |       AT        GC A  |       CG       T  T CG       |  G       TA TG       G  A       GC GC        GC        CG TA        GC        TG TG        AT        TA                         TCTTTATTTCCCAGAATCAGGGGAAACAGCTCTTCTGCTTGTCTTCTCTTCTGCGGGGATCCCTATTTCTTAAagacatttccctcttttagataaatatacgaaattgtttgcctagagctatttttatgttatgacggcataagagcgatttgtttgtaggaacttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1109 Phosphomannomutase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:192 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-10.00 kcal/mol Antiterminator: Size=42 nt.     Delta G= -6.80 kcal/mol Anti-antiterminator:   Size=34 nt.     Delta G=-10.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TAGTTGGTGATTTTTGGGTTTTGCCCGGCGATAAGCTTATCGAAAGAGAAGAAGATTG TCAGCTACTCTTATCTTTATCGGGAGATAGGGTAGGGCAGGGAGTATTTTTCGTTGGA CCTTATCCTACGGATCTTTATTTCCCAGAATCAGGGGAAACAGCTCTTCTGCTTGTCT TCTCTTCTGCGGGGATCCCTATTTCTTAAagacatttccctcttttagataaatatacgaaattgtttgcctagagcta tttttatgttatgacggcataagagcgatttgtttgtaggaacttttATG     CCA00344 Gene: CCA00344     GI: 29840108     BI number: CCA00344     GOG: COG1109     Description: phosphoglucomutase/phosphomannomutase family protei             A        GG           C  G      G  A           T  C       CG            GT        TA            TA        AT AA       T  C       TA G  A       AT        TG CG        GC        TG TA        AT        CG A  G       AT       |  T TA       G  A      |  A TA       A  |      |  G CG        AT       |  G G  A       GC       |  G A  A       AT       T  C A  G       GT       A  A TA        AT        TG AT       A  A       TG GT        AT        CG CG        GC        TA GT        CG        CG GC        TG        AT                         ATTTTTCGTTGGACCTTATCCTACGGATCTTTATTTCCCAGAATCAGGGGAAACAGCTCTTCTGCTTGTCTTCTCTTCTGCGGGGATCCCTATTTCTTAAagacatttccctcttttagataaatatacgaaattgtttgcctagagctatttttatgttatgacggcataagagcgatttgtttgtaggaacttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1109 Phosphomannomutase ... can be seen here     ..................................................................................................................