Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:118 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-20.00 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTACCATGGTCGTTACAGTTATAGCTATGATCGTTGGAGCTATTATTATTGCCAATGC
ATCTGATTCTACCCCAGCTAATGGTGGAACAAATCCTACCCCACCGACTCCTTAGaatc
tctacttagagtccttgctctagtatgaaagagacagaaccttaaggggttctgtctttttttttatgtcgataagccctacttcaaacaagatttgttg
gtttttgcgttaatttatattaattaattagagtcaaacaattatcatataattaaatcgttttatttattttacttattattATG

    CCA00351


Gene: CCA00351     GI: 29840115     BI number: CCA00351     GOG: NOG08326     Description: conserved hypothetical protei


           ct
          c  t
           tg
           gc
           at        aa
           gc       t  g
  t        at        tg
a  c      t  |       cg
a  t       ta        cg
 Gc        cg        at
 At        at        at
 Ta       |  a       gc
|  c      |  t       at
|  t      |  g       cg
T  t      |  a       at
C  a      |  a       gc
 Cg        ta        at
 Ta        cg        gt
 Cg        ta        at
 At        cg        at
 Gc        ta        at
                        ttttatgtcgataagccctacttcaaacaagatttgttggtttttgcgttaatttatattaattaattagagtcaaacaattatcatataattaaatcgttttatttattttacttattattATG


    ..................................................................................................................