                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTGCACTATTAATTCCAGGATGCACACTAATTCCTAAAGAATGGGATTGCCCCTGCT
CATACCATCAGCAAGAGTCTAGCTCTCAGGTAAAATAAcgaaaaccaaagggaatagccctagggttttcta
tgatttcgggacttgtttttatttttttctttgttataacttaacaggaataacaactcagtatccctattcataggaaaatatgaattctgtgaaagca
cggggcgctttacaaaagcaaactttcactacctgagccaacgatatttgttaatgtaaggacagcaattATG

    CCA00395 --- CCA00394 Gene: CCA00395     GI: 29840157     BI number: CCA00395     GOG: NOG05407     Description: conserved hypothetical protein Gene: CCA00394     GI: 29840156     BI number: CCA00394     GOG: COG1266     Description: conserved hypothetical protei   T C  A T  G GC        AA AT       T  c GC       A  g AT       A  a A  C      A  a        t C  A      A  a      a  a G  |       Ta       a  g A  |       Gc        gc C  |       Gc        gc T  |      A  a       gc A  |      C  a       at CG        Ta       a  a CG        Cg       a  g AT        Tg        cg TA        Cg        cg                         ttttctatgatttcgggacttgtttttatttttttctttgttataacttaacaggaataacaactcagtatccctattcataggaaaatatgaattctgtgaaagcacggggcgctttacaaaagcaaactttcactacctgagccaacgatatttgttaatgtaaggacagcaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1266 Predicted metal-dependent membrane protease ... can be seen here     ..................................................................................................................