                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-10.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCTGCTATCTCATGCCACAAGAATCATAGACACTCAGCTGCTTGCAAGCGTGTATGT
TCTTCTTCAGCTAAAAGAAGATGTGGTTCTAAAAGTCGTGTTCGTACAGCTCATGGCT
GGCGTCAACAATTAATGAAACTCGTTTCTCGTTAGaaacaggttttgttagacgagggtgaacggtaaggcttt
ataaaagtttcttaccgttttttttgcctgttatagactccctctgtacagttagatgagtaaagggtatagtaaatctctaggcgtatctgtgctagga
ggttcaggagATG

    CCA00413 --- CCA00414 Gene: CCA00413     GI: 29840175     BI number: CCA00413     GOG: COG1466     Description: conserved hypothetical protein Gene: CCA00414     GI: 29840176     BI number: CCA00414     GOG: COG0313     Description: tetrapyrrole methylase family protei            gt           t  t            ta         t GT        tg       a  a C  T       ta        ta TA        gc        ta CG       |  g       ta Ta       |  a       cg Ta       g  g       gt Ta       a  g      |  t Gc        cg       |  t C  a       at        gc T  g      a  g       at Cg       a  |       at At       G  |       ta At       A  |       gc At        Ta        gc G  t       Ta        cg T  g       Gc        at At        Cg        at At        Tg        gt                         tttttgcctgttatagactccctctgtacagttagatgagtaaagggtatagtaaatctctaggcgtatctgtgctaggaggttcaggagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1466 DNA polymerase III, delta subunit ... can be seen here [R] COG0313 Predicted methyltransferases ... can be seen here     ..................................................................................................................