                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:35 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-10.10 kcal/mol
Antiterminator:    Distance from promoter:34 nt. Size=49 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:    Distance from promoter:24 nt.    Size=37 nt.     Delta G=-12.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtag-taacgt. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtagactattttgttctatgctaacgtctttatttcttagagacattcgcacggagtatagcgcagcctggttagcgcggttgctttgggagcaatag
gtcgggggttcgaatccctctactccgaattgtttagttgtttataacaaaagattttcaggaagtcactgATG

    fer4 Gene: fer4     GI: 29840189     BI number: CCA00427     GOG: COG0633     Description: ferredoxi             g           t  g            tg            ta            cg            gc            ta        cg   t        ta       t  a c  g       gt        ta cg       g  a       gt gt       c  g       gc at       g  |       gc |  a       cg        gc cg        gt        gt gc       a  c      c  | cg       t  g      t  | gc       t  g      g  | |  g      g  |       gc a  g      g  |       at t  t       tg        ta at        cg       a  | tg        cg       a  | gc        gt       c  | at        at        gc gt       c  |       at gt        gc        gc cg        cg        gc                         gaattgtttagttgtttataacaaaagattttcaggaagtcactgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0633 Ferredoxin ... can be seen here     ..................................................................................................................