                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:46 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G= -8.50 kcal/mol
Antiterminator:    Distance from promoter:87 nt. Size=33 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:    Distance from promoter:69 nt.    Size=32 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-CACATT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATTAAGAAAAATGATCGAACCACATTTTCCAGATCTTCTTGTTTTATCGCATAA
TGAACTCCCTGAAGAAATCCCTATTTCCCTTTTAGGATCTGTCTCAGATGAGGTTTTG
ACACTTTAAttgtgaatttaatctaattaaaatgaataaattcttttaattagaatgttgtttaaaatattttttatttaatcttaaaataatt
actgaagaaaaaatttGTG

    CCA00429 Gene: CCA00429     GI: 29840191     BI number: CCA00429     GOG: COG1191     Description: RNA polymerase sigma factor, sigma-70 famil            tt        aa TG       t  a      t  a T  A      a  a       at T  C       at        at TA        gc        gc GC       t  |      t  | GT        gt        at AT        ta        at GT        ta        at TA        At        at A  A       At        ta Gt        Ta        ta At        Ta        at Cg        Ta        at T  t      C  a       ta Cg        At        cg Ta        Cg        ta                         atgttgtttaaaatattttttatttaatcttaaaataattactgaagaaaaaatttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1191 DNA-directed RNA polymerase specialized sigma subunit ... can be seen here     ..................................................................................................................