                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:108 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=66 nt.     Delta G= -7.16 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTACAGCTAAAATTGCGAGAGTAAGAAGTACCGCCGAAGTGATACGGATAAGCGTGGT
AGATGGAATAAATTTTGCTGTTTTACTTTGTGTTTGTTGAATACTTGGGGTATTACTT
GAATGTGGGGTTATAGCAGCCACtgaaaacctttaaaaagaaaaaacgatccattttaatctaaaaatggatttttctccatt
attttttctgtatagaactaatcatagaaggggaatcttgcatataagaagaccgatagttaagatagtacttcaattattaagatttttttgtagttgt
cATG

    tyrS --- gnd Gene: tyrS     GI: 29840193     BI number: CCA00431     GOG: COG0162     Description: tyrosyl-tRNA synthetase Gene: gnd     GI: 29840194     BI number: CCA00432     GOG: COG0362     Description: 6-phosphogluconate dehydrogenase, decarboxylatin             C           C  A            GC            At            Cg           G  a           A  a           T  |           A  |            Ta            Ta            Gc            Gc            Gt   G        Gt T  G      T  t T  G      G  a CG       T  a AT       A  a TA       A  | AT       G  | AT        Ta G  A       Ta T  C       Cg T  T      |  a GT       |  a       tc TG       |  a      a  t TA       A  a      a  a TA       T  a       ta GT       T  a       ta TG       A  c       ta G  T      T  g       ta T  G      G  a       at TG        Gt        cg TG        Gc        cg CG        Gc        ta AT        Ta        at                         ttttctccattattttttctgtatagaactaatcatagaaggggaatcttgcatataagaagaccgatagttaagatagtacttcaattattaagatttttttgtagttgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0162 Tyrosyl-tRNA synthetase ... can be seen here [G] COG0362 6-phosphogluconate dehydrogenase ... can be seen here     ..................................................................................................................