                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:108 nt.    Distance to gene:56 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-15.80 kcal/mol
Antiterminator:    Distance from promoter:81 nt. Size=37 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:    Distance from promoter:46 nt.    Size=56 nt.     Delta G= -3.34 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatg-taaact. It has a score value of 78.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatgaaaaacttaaatacgctaaactggtctaaaagtttttctgttaggcgtttttatatttaatatcttaaatatatcattttgaaattttcagctt
ttcgtctcagaaaatcttaaataatagtatattatctgagattatccctctttattgagggatagaacctcaatcttttagaccatcctctaagttatat
gaggaaaagaaaatgacagtatagaagtcacaagATG

    CCA00495 --- mgtE Gene: CCA00495     GI: 29840255     BI number: CCA00495     GOG: COG0457     Description: conserved hypothetical protein Gene: mgtE     GI: 29840256     BI number: CCA00496     GOG: COG2239     Description: magnesium transporte tc t  g t  t t  c c  t g  c a  a cg ta ta         t        ta ta       g  a      t  t ta        at       t  t at        ta        cg a  c       at        ta at        at        cg gt        ta        cg ta        at        cg ta       a  c       ta ta        at        at t  t       tg        ta a  a       ta        tg c  a       cg       |  a t  t       ta       |  a a  a       at       a  c tg        at        gc at       a  a       at ta        at        gc at        gc        ta                         atcttttagaccatcctctaagttatatgaggaaaagaaaatgacagtatagaagtcacaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0457 FOG: TPR repeat ... can be seen here [P] COG2239 Mg/Co/Ni transporter MgtE (contains CBS domain) ... can be seen here     ..................................................................................................................