                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:107 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -4.46 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCTACCGACAAATTGATGGGCTATGCAGTGCCTTAGGAATTTCTGAGCGAGAATTAA
TAAGATTCATTCTGTCTAAAAAAATAGCAGGAGAGATTCTCCCAAAACTTTTATAAaa
ggctctttggtaattcgttaagtgagtcccgtgaatagggatttttataatttaatctctattcactttttatattttaaatatttaaaattgaccttaa
aatgcgtatctcgtgtccagaaccatcattcatcttcttcttaatggcataggcgggatttttatgaatttttaggttgattttGTG

    CCA00501 --- CCA00502 --- CCA00503 --- CCA00504 Gene: CCA00501     GI: 29840261     BI number: CCA00501     GOG: COG1135     Description: ABC transporter, ATP-binding protein Gene: CCA00502     GI: 29840262     BI number: CCA00502     GOG: COG2011     Description: ABC transporter, permease protein Gene: CCA00503     GI: 29840263     BI number: CCA00503     GOG: COG1464     Description: lipoprotein, YaeC family Gene: CCA00504     GI: 29840264     BI number: CCA00504     GOG: -------     Description: hypothetical protei AT T  A TA Ta Ta Cg |  g |  c |  t A  c At At At Cg Cg |  t |  a |  a                 ta |  t                a  a |  t                t  t |  c                t  t |  g                t  t |  t        a        ta |  t      g  a       ta |  a      t  t       at |  a      g  a       gc C  g       cg        gt T  t       cg        gc Cg        cg        at Ta        ta        ta Tg        gt        at At        at        at Gc        gt        gc                         actttttatattttaaatatttaaaattgaccttaaaatgcgtatctcgtgtccagaaccatcattcatcttcttcttaatggcataggcgggatttttatgaatttttaggttgattttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1135 ABC-type metal ion transport system, ATPase component ... can be seen here [P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.70 kcal/mol Antiterminator: Size=21 nt.     Delta G= -8.10 kcal/mol Anti-antiterminator:   Size=76 nt.     Delta G=-12.46 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACCTACCGACAAATTGATGGGCTATGCAGTGCCTTAGGAATTTCTGAGCGAGAATTAA TAAGATTCATTCTGTCTAAAAAAATAGCAGGAGAGATTCTCCCAAAACTTTTATAAaa ggctctttggtaattcgttaagtgagtcccgtgaatagggatttttataatttaatctctattcactttttatattttaaatatttaaaattgaccttaa aatgcgtatctcgtgtccagaaccatcattcatcttcttcttaatggcataggcgggatttttatgaatttttaggttgattttGTG     CCA00501 --- CCA00502 --- CCA00503 --- CCA00504 Gene: CCA00501     GI: 29840261     BI number: CCA00501     GOG: COG1135     Description: ABC transporter, ATP-binding protein Gene: CCA00502     GI: 29840262     BI number: CCA00502     GOG: COG2011     Description: ABC transporter, permease protein Gene: CCA00503     GI: 29840263     BI number: CCA00503     GOG: COG1464     Description: lipoprotein, YaeC family Gene: CCA00504     GI: 29840264     BI number: CCA00504     GOG: -------     Description: hypothetical protei AA A  A A  A AT TA CG T  | GC TA CG TG TA A  | CG TA T  | A  | G  | A  | A  | T  | A  | A  | TG TA AT AT GC AT GC |  C |  C |  A |  A |  A |  A                 ta |  C                a  a |  T                t  t |  T                t  t |  T                t  t |  T                 ta |  A        t        ta |  T      t  g       at |  A      t  g       gc |  A      c  t       gt |  a       ta        gc |  a       ca        at |  g       gt        ta Cg        gt        at Gc        ac        at At        ag        gc Gc        At        ta                         ctttttatattttaaatatttaaaattgaccttaaaatgcgtatctcgtgtccagaaccatcattcatcttcttcttaatggcataggcgggatttttatgaatttttaggttgattttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1135 ABC-type metal ion transport system, ATPase component ... can be seen here [P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.20 kcal/mol Antiterminator: Size=28 nt.     Delta G= -4.30 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G= -5.09 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACCTACCGACAAATTGATGGGCTATGCAGTGCCTTAGGAATTTCTGAGCGAGAATTAA TAAGATTCATTCTGTCTAAAAAAATAGCAGGAGAGATTCTCCCAAAACTTTTATAAaa ggctctttggtaattcgttaagtgagtcccgtgaatagggatttttataatttaatctctattcactttttatattttaaatatttaaaattgaccttaa aatgcgtatctcgtgtccagaaccatcattcatcttcttcttaatggcataggcgggatttttatgaatttttaggttgattttGTG     CCA00501 --- CCA00502 --- CCA00503 --- CCA00504 Gene: CCA00501     GI: 29840261     BI number: CCA00501     GOG: COG1135     Description: ABC transporter, ATP-binding protein Gene: CCA00502     GI: 29840262     BI number: CCA00502     GOG: COG2011     Description: ABC transporter, permease protein Gene: CCA00503     GI: 29840263     BI number: CCA00503     GOG: COG1464     Description: lipoprotein, YaeC family Gene: CCA00504     GI: 29840264     BI number: CCA00504     GOG: -------     Description: hypothetical protei   A G  T A  T GC AT GC GC |  C |  A |  A A  A C  A        t GC       a  t AT       a  c T  T      t  g A  T       gt A  T       gt A  A       ta         a A  T       ta       g  a A  A       tg       t  t A  A      |  t      g  a A  a       cg        cg Ta        ta        cg Cg        cg        cg Tg        gt        ta Gc        gc        gt                         ttttataatttaatctctattcactttttatattttaaatatttaaaattgaccttaaaatgcgtatctcgtgtccagaaccatcattcatcttcttcttaatggcataggcgggatttttatgaatttttaggttgattttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1135 ABC-type metal ion transport system, ATPase component ... can be seen here [P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here     ..................................................................................................................