Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:114 nt.    Distance to gene:11 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -8.70 kcal/mol
Antiterminator:    Distance from promoter:96 nt. Size=31 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaagt-tttaat. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaagtattccgttggattgttgtttaatttttatcaagaacccgacatgaataagtcgtgttgttgtctaaaaaagatggccaacaggacgcttaaagc
tgtattgacttttttcgcgctgctggatataaggcattcttttaatgcaacgtatcattagacatttatgttgtatttcttttaggtgttttATG

    CCA00505 --- gyrB --- gyrA --- tmk --- CCA00509


Gene: CCA00505     GI: 29840265     BI number: CCA00505     GOG: NOG08093     Description: conserved hypothetical protein
Gene: gyrB     GI: 29840266     BI number: CCA00506     GOG: COG0187     Description: DNA gyrase, subunit B
Gene: gyrA     GI: 29840267     BI number: CCA00507     GOG: COG0188     Description: DNA gyrase, subunit A
Gene: tmk     GI: 29840268     BI number: CCA00508     GOG: COG0125     Description: thymidylate kinase
Gene: CCA00509     GI: 29840269     BI number: CCA00509     GOG: COG0470     Description: DNA polymerase III, tau subunit, putativ



           ag
  t       t  a
t  t      t  c
c  t      a  a
 ta       c  t
 ta       t  t
 at        at
 cg        ta
 gc        gt
g  a       cg
a  a       at
a  c       at
 tg        cg
 at        gt
 ta        ta
 at        at
 gc        at
            tcttttaggtgttttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0187 Type IIA topoisomerase (DNA gyrase/topo II, topoisomerase IV), B subunit ... can be seen here
[L] COG0188 Type IIA topoisomerase (DNA gyrase/topo II, topoisomerase IV), A subunit ... can be seen here
[F] COG0125 Thymidylate kinase ... can be seen here
[L] COG0470 ATPase involved in DNA replication ... can be seen here

    ..................................................................................................................