                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTGATATTACAATCTTACGCCCCTTGATTCTTACTCCTGAATCATGGATACGTAAGT
TTGCTAAAGAAAGTGGGTTCGCTCGTGTTACCTGCCGCTGCCCCGTTGTCTCCTTAAG
AACAAAAACGGAATCCGCTTTAAAGTTGCTGGAAGATGTTTTCCCTCAAGCGCGACAT
AATATTGCTTTAGCAATTGAGCAACACGGTTTATCAAAAGCCCAAAAAATTAAAACCA
ATTAAacatgtttttataaatcattcttgctaaaatctttatagcaagatttattttccggtaattttATG

    CCA00520 Gene: CCA00520     GI: 29840279     BI number: CCA00520     GOG: COG0496     Description: phosphatase, SurE famil AA A  C A  C TA TA AT AT A  A A  A A  a A  c C  a C  t Cg Gt At At At At C  | Ta At Ta Ta         c Ta       t  t Gt       a  t Gc       a  t |  a      a  a C  t       at A  t       ta C  c       cg At        gc At        ta Cg        ta Gc        cg At        ta             tttattttccggtaattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0496 Predicted acid phosphatase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.70 kcal/mol Antiterminator: Size=70 nt.     Delta G= -9.40 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G= -4.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTGATATTACAATCTTACGCCCCTTGATTCTTACTCCTGAATCATGGATACGTAAGT TTGCTAAAGAAAGTGGGTTCGCTCGTGTTACCTGCCGCTGCCCCGTTGTCTCCTTAAG AACAAAAACGGAATCCGCTTTAAAGTTGCTGGAAGATGTTTTCCCTCAAGCGCGACAT AATATTGCTTTAGCAATTGAGCAACACGGTTTATCAAAAGCCCAAAAAATTAAAACCA ATTAAacatgtttttataaatcattcttgctaaaatctttatagcaagatttattttccggtaattttATG     CCA00520 Gene: CCA00520     GI: 29840279     BI number: CCA00520     GOG: COG0496     Description: phosphatase, SurE famil            tc           a  a           a  t            at            tc            at            tt           t  g           t  c AA       t  t A  C      t  a A  C      g  a TA       t  a TA        aa AT        ct AT        a A  A       A A  A       A A  a       T A  c      T  | C  a       A C  t       A Cg        C Gt        C         c At        A       t  t At        A       a  t At        A       a  t At       |        a  a C  |      A         at Ta       T         ta At       T         cg Ta        A        gc Ta        A        ta Ta        A        ta Gt        A        cg Gc        A        ta                         tttattttccggtaattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0496 Predicted acid phosphatase ... can be seen here     ..................................................................................................................