Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=2 nt.   Size=20 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -5.76 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

acaagaaaaacttcagagacgtagattcttacatcttttgattaaaattcctagagatcttgttggatttacatgaaaaatgcgggaatcacttcttttg
ttcaaaataatctctcaaatctttgagagagcatttttataaaaacgcccaaaaatcctatttctcctcagttgcttagagtttatattttttctttgtc
tatgaaaatcaacggcataacttttggtaaagatcttgattttatacattcatgtaattagtctgtgtcaaatttaattttttaagatggaaataacccc
ATG

    incA


Gene: incA     GI: 29840309     BI number: CCA00550     GOG: NOG14661     Description: inclusion membrane protein


           ca
          t  c
           at
           at
           gc
           gt
           gt
          c  t
          g  t
 gt       t  g
t  t      a  |
 tg       a  |
 cg       a  |
 ta        at
 at        at
 gt        gc
 at        ta
|  a      a  a
|  c      c  a
|  a      a  a
|  t      t  t
|  g       ta
|  a       ta
|  a       at
|  a       gc
|  a       gt
|  a      t  c       tc
|  t      t  t      a  t
g  g       gc        at
a  c       ta        at
 tg        ta        cg
 cg       c  |       ta
 cg        ta        cg
 ta        at        ta
 ta        gc        cg
 at        at        ta
                        gcatttttataaaaacgcccaaaaatcctatttctcctcagttgcttagagtttatattttttctttgtctatgaaaatcaacggcataacttttggtaaagatcttgattttatacattcatgtaattagtctgtgtcaaatttaattttttaagatggaaataaccccATG


    ..................................................................................................................