                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:202 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atagacaaagaaaaaatataaactctaagcaactgaggagaaataggatttttgggcgtttttataaaaatgctctctcaaagatttgagagattatttt
gaacaaaagaagtgattcccgcatttttcatgtaaatccaacaagatctctaggaattttaatcaaaagatgtaagaatctacgtctctgaagtttttct
tgtagatatcttcttttcggggatatggtgagataaatgatttgctaactacaccttagagaggcttctttaattttgatgtgtttgcaataggcaataa
GTG

    rpe --- CCA00552 --- accB --- accC Gene: rpe     GI: 29840310     BI number: CCA00551     GOG: COG0036     Description: ribulose-phosphate 3-epimerase Gene: CCA00552     GI: 29840311     BI number: CCA00552     GOG: COG0231     Description: translation elongation factor P, putative Gene: accB     GI: 29840312     BI number: CCA00553     GOG: COG0511     Description: acetyl-CoA carboxylase, biotin carboxyl carrier protein Gene: accC     GI: 29840313     BI number: CCA00554     GOG: COG0439     Description: acetyl-CoA carboxylase, biotin carboxylas            at ag       t  a g  a       ta g  a       ta a  a       ta gt        ta ta        gt cg        cg |  g       gc a  a       gt a  t       gc c  t      t  | gt       t  | at       t  | at       t  | tg       t  | cg       a  | tg       g  |       ga |  c      g  |      a  t cg       a  |       at at       t  |       at at       a  |       cg at       a  |       ta t  t       at        cg at        gc        ta ta        at        cg at        gc        ta                         ttattttgaacaaaagaagtgattcccgcatttttcatgtaaatccaacaagatctctaggaattttaatcaaaagatgtaagaatctacgtctctgaagtttttcttgtagatatcttcttttcggggatatggtgagataaatgatttgctaactacaccttagagaggcttctttaattttgatgtgtttgcaataggcaataaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0036 Pentose-5-phosphate-3-epimerase ... can be seen here [J] COG0231 Translation elongation factor P (EF-P)/translation initiation factor 5A (eIF-5A) ... can be seen here [I] COG0511 Biotin carboxyl carrier protein ... can be seen here [I] COG0439 Biotin carboxylase ... can be seen here     ..................................................................................................................