                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=57 nt.     Delta G=-10.61 kcal/mol
Anti-antiterminator:   Size=13 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATATTGGAGGGGTGCATTCTACTATACCTTTCCATCAATTCATGTTGGACAATCCAC
AATTCATCAATTCAGACTATGATATCAACTACGTTGATCATCTTCTCTCTCAGGGGAA
TACCCTATTTTAAaagttctttgtaattctcgtgtctagagattcgttctctagacaggtttgtttcttttttaattaagaaatcttaata
aaattacttgcattaaaaactgttataacaattaacgctttttgttataatgttttaagattgttaaattttatttaaatatttttaatctttATG

    CCA00555 Gene: CCA00555     GI: 29840314     BI number: CCA00555     GOG: -------     Description: hypothetical protei             A           A  a           T  a           T  g           T  t           T  t           A  c           T  t           C  t           C  t            Cg            At           |  a            Ta            At            At            Gc            Gt         c            Gc       t  g           G  g      t  t            At        at            Cg        gc           |  t       at   A       T  c       gc A  T      C  t       at G  A       Ta        ta GC        Cg        cg GC        Ta        ta GC        Cg        gc AT        Ta        ta                         ggtttgtttcttttttaattaagaaatcttaataaaattacttgcattaaaaactgttataacaattaacgctttttgttataatgttttaagattgttaaattttatttaaatatttttaatctttATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:118 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G=-14.10 kcal/mol Antiterminator: Size=57 nt.     Delta G=-10.61 kcal/mol Anti-antiterminator:   Size=13 nt.     Delta G= -5.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CATATTGGAGGGGTGCATTCTACTATACCTTTCCATCAATTCATGTTGGACAATCCAC AATTCATCAATTCAGACTATGATATCAACTACGTTGATCATCTTCTCTCTCAGGGGAA TACCCTATTTTAAaagttctttgtaattctcgtgtctagagattcgttctctagacaggtttgtttcttttttaattaagaaatcttaata aaattacttgcattaaaaactgttataacaattaacgctttttgttataatgttttaagattgttaaattttatttaaatatttttaatctttATG     CCA00555 Gene: CCA00555     GI: 29840314     BI number: CCA00555     GOG: -------     Description: hypothetical protei             t           g  a           t  a           t  t           t  t           c  c           t  t           t  c           g  g           a  t            ag            At           |  c            At            Ta            Tg            Ta            Tg         c            Aa       t  g           T  t      t  t            Ct        at            Cc        gc           |  g       at   A       C         gc A  T      A         at G  A       T        ta GC        A        cg GC        A        ta GC        G        gc AT        G        ta                         ggtttgtttcttttttaattaagaaatcttaataaaattacttgcattaaaaactgttataacaattaacgctttttgttataatgttttaagattgttaaattttatttaaatatttttaatctttATG     ..................................................................................................................