                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:58 nt.    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.50 kcal/mol
Antiterminator:    Distance from promoter:31 nt. Size=43 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -5.46 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttt-tagaca. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttttgaactgtgttgttaactagacatcttgttagcttcacgaccgttattttacgtcgttttgtcatttctcctatgtgtctgtaggctatgccaa
gcgatggtatgtactgttttgtttgttgttatttcattcaaaagaaaaattacgttttataattaggagaaaacataATG

    trpB Gene: trpB-1     GI: 29840318     BI number: CCA00559     GOG: COG0133     Description: tryptophan synthase, beta subuni tt a  t t  t ta gc c  |       gt cg       t  c at       g  t gc        tg cg        at at        ta c  t       cg t  t       cg t  |      t  c        c c  |      c  t      g  g g  |      t  |      a  a a  |      t  |       at t  |       ta        cg t  |       at        cg g  |       cg        gt t  |      t  c       ta t  |       gc        at c  |       ta        tg t  |      t  |      c  t at        ta       g  a cg        tg        gc at        gc        at gc        cg        tg                         ttttgtttgttgttatttcattcaaaagaaaaattacgttttataattaggagaaaacataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0133 Tryptophan synthase beta chain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:189 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -8.80 kcal/mol Antiterminator: Size=35 nt.     Delta G= -5.70 kcal/mol Anti-antiterminator:   Size=47 nt.     Delta G= -6.53 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgaaaatgctgttccatattaaagaacaaatgtcaaaattgagtttttatttagaaagctcttctttctcccaaatgttttggtgggcttgcgcccgtt aatctttttatttcattcaatttttgttttgaactgtgttgttaactagacatcttgttagcttcacgaccgttattttacgtcgttttgtcatttctcc tatgtgtctgtaggctatgccaagcgatggtatgtactgttttgtttgttgttatttcattcaaaagaaaaattacgttttataattaggagaaaacata ATG     trpB Gene: trpB-1     GI: 29840318     BI number: CCA00559     GOG: COG0133     Description: tryptophan synthase, beta subuni   t t  t a  a tg ta ta ta tg gc at         g gc       t  t t  |       at t  |       at a  |       at a  |       cg a  |       cg a  |      c  t c  |      t  | t  |      c  | g  |      t  | t  |      t  |       tg a  |      t  |      t  c a  |      c  |       cg a  |      t  |       gc c  |      t  |       gc at        cg        gc at        tg        tg gc        cg       g  t at        gc       g  t at        at        ta at        at        ta                         tctttttatttcattcaatttttgttttgaactgtgttgttaactagacatcttgttagcttcacgaccgttattttacgtcgttttgtcatttctcctatgtgtctgtaggctatgccaagcgatggtatgtactgttttgtttgttgttatttcattcaaaagaaaaattacgttttataattaggagaaaacataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0133 Tryptophan synthase beta chain ... can be seen here     ..................................................................................................................