Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -6.86 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -4.24 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgtatgcctacgtgtaaagatatagttttggtggcatatttttccagtcttttatttcttcatgtctaaattatttagaatttcttcgtattcctaaatt
atttagataaatctaacaaagacattgcatcacttacccataatttaatcattgaactcaatgatgaagagaagttgtttcaaaaaccagtctctttgtc
catctattttttctcttatggactcattttttcaaatttcattagagaatggctgagagccatttcttttgtttatgtttcgcagaataaaggagatgca
ATG

   ف --- CCA00561


Gene: CCA00561     GI: 29840319     BI number: CCA00561     GOG: NOG09341     Description: conserved hypothetical protein
Gene: trpR     GI: 29840320     BI number: CCA00562     GOG: COG2973     Description: trp operon represso


            t
          t  t
          t  t
          t  c
          a  a
          c  a
          t  a
 tt       c  t        a
t  t       at       g  g
t  c       gt       t  a
t  t       gc        cg
a  c       ta        gc
t  t       at        gc
c  t      t  t       ta
 ta        ta       |  t
 at        cg        at
 cg        ta        at
 cg        cg        gc
 ta        ta        at
 gc        ta        gt
                        ttgtttatgtttcgcagaataaaggagatgcaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG2973 Trp operon repressor ... can be seen here

    ..................................................................................................................