                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G= -8.87 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCATGGTTTATAAAAATAAAAATGCTAAGGCTTTGGACAAAGAATACGAAACGTTCAC
GAAATCATTTAAGATTACCAAAGTGCGTGAAGCGAGAGTTATAGATTTAAAAAAGAAA
GTCAGACTTTAAAAGACGTGTTTTTCTCTTTGTTATGAATAAAGATTCATAGAAGGTT
TGCCTTTTCGAGTCTAGTTTTTCGCTACCTCTAGAGTCGAAAGGGCTATCTTCACCTC
CAGCTTTTTCATTCTTTTTAACAGTGTGTTTTTCTATAAGGAACCAGAATCCGATAGA
GGGAATTTTTATG

    CCA00593 Gene: CCA00593     GI: 29840351     BI number: CCA00593     GOG: COG0775     Description: 5'-methylthioadenosine nucleosidase-related protei   A C  G T  A GC AT AT AT G  A A  A A  A A  A A  G A  A A  C T  G T  T TG AT GT AT T  T A  T                 TT T  |       AA       T  G T  |      A  G       GC GC        TA        GC AT        AT        AT GC        AT        AT AT        GC        GT GT        TA        AT C  T       AT       T  C G  G       TA       A  | A  |       TG        CG AT       G  |       TA GT        TA        TG TA        TA        AT GT        TG        GC CG        CG        AT                         AGTTTTTCGCTACCTCTAGAGTCGAAAGGGCTATCTTCACCTCCAGCTTTTTCATTCTTTTTAACAGTGTGTTTTTCTATAAGGAACCAGAATCCGATAGAGGGAATTTTTATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0775 Nucleoside phosphorylase ... can be seen here     ..................................................................................................................