                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.54 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATCTTGTTGCAGAAGAGCCCGCCAGTCAATCTGTGATTAGTGAATAGactgtgatgtgtttct
agttgtcatgttgtttgaatggcaatagagcgtaactaactgtagttaagaaagaatcgtaaaataagaaatctaatattgttgcatttactttttaaac
aaagaaggactttaggcgaattttcccggagtccttttttgttattcttgtatattgcaatcatccctttccctcactatagttagctcaatataagcga
agatagaaaatctcaaaaaggcaaggagtttgccccATG

    CCA00618 --- ligA Gene: CCA00618     GI: 29840376     BI number: CCA00618     GOG: COG0515,COG1262     Description: protein kinase, putative Gene: ligA     GI: 29840375     BI number: CCA00617     GOG: COG0272     Description: DNA ligas aa a  t gc at |  a |  a at ta at at         a |  g      a  c at       a  a at        ta tg        ta        at gc        tg       a  t c  a       ta       g  t t  t       ta       c  t at        cg        gc at       a  g       gc |  a      t  a      a  c gc       t  c      t  g at       t  t       tg at       a  t       ta at       c  t       cg gt       g  a       at at        tg        gc a  a       tg        gc ta        gc        at ta        tg        at gc        ta        gt                         tttgttattcttgtatattgcaatcatccctttccctcactatagttagctcaatataagcgaagatagaaaatctcaaaaaggcaaggagtttgccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [RTKL] COG0515 Serine/threonine protein kinase ... can be seen here [S] COG1262 Uncharacterized conserved protein ... can be seen here [L] COG0272 NAD-dependent DNA ligase (contains BRCT domain type II) ... can be seen here     ..................................................................................................................